| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076517 |
| Chromosome: | chromosome 10 |
| Location: | 3994075 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447300 | DDI1 | DNA-damage inducible protein 1 homolog; (1 of 1) K11885 - DNA damage-inducible protein 1 (DDI1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCGGTGGAAGCCAAAAACCATTAAGCTGTTGGCTGTTGTATGGTGTG |
| Internal bar code: | AATATACGCGCGATGGACACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1141 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCAGAGCAATCGTGATGT |
| Suggested primer 2: | ATTGAGTCACGCGCACCTTA |