| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.076525 |
| Chromosome: | chromosome 9 |
| Location: | 5282500 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407200 | POD1 | Putative all-trans-retinol 13%252C14-reductase; (1 of 3) 5.2.1.13 - Prolycopene isomerase / CRTISO | 3'UTR |
| Cre09.g407250 | FAP270 | (1 of 3) PTHR24193//PTHR24193:SF87 - ANKYRIN REPEAT PROTEIN // SUBFAMILY NOT NAMED; Flagellar Associated Protein 270 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGAAGGCAAATCGGAAAGTCTCGGCACAGCTATAAGCATACACACGT |
| Internal bar code: | ATTGGGCGGCTGGGCAGTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 868 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTTCACGTTCCCGAGTT |
| Suggested primer 2: | GCTGGTGCGTTTGATTGGTT |