Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.076550 |
Chromosome: | chromosome 3 |
Location: | 6470735 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g193500 | TGL8,CGLD15,PGD1,PML1 | (1 of 2) PTHR21493//PTHR21493:SF124 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // SUBFAMILY NOT NAMED; Plastid galactoglycerolipid degredation 1 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCTGCTAGTTCAACCTACACCGAAGCGCACCGCCTACCAGCTACTGGA |
Internal bar code: | TACGAAGTTAAGTTAATCCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2609 |
LEAP-Seq percent confirming: | 98.3871 |
LEAP-Seq n confirming: | 61 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTACATAGGGACCCACAG |
Suggested primer 2: | TAGGTGCCTCTCTCAGTCCC |