| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076564 |
| Chromosome: | chromosome 12 |
| Location: | 450591 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494900 | PPP37 | (1 of 1) K15423 - serine/threonine-protein phosphatase 4 catalytic subunit (PPP4C); Putative Serine/threonine-protein phosphatase PP2A-3 catalytic subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGACACCAGCAGCCCCGAGCATGGCAGCCCGACGTCTTGGCGGGGACT |
| Internal bar code: | TCGCCAGGGCAGGTGCGAATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACATCTACACACGGACCA |
| Suggested primer 2: | ACATACACCTTCGCAACCGT |