| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.076622 |
| Chromosome: | chromosome 7 |
| Location: | 2650593 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330550 | 3'UTR | ||
| Cre07.g330600 | (1 of 2) K01510 - apyrase (ENTPD1_3_8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGTGGACTGTCACTGTCCGACTGGGGACATCCGAGGCTCTCTCGCACT |
| Internal bar code: | GGCGGGGGCGAAGTACGTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2400 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATTGAATACGCCAGCTG |
| Suggested primer 2: | GTGGTTGTCAAGGTGGTGGA |