| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.076626 |
| Chromosome: | mitogenome |
| Location: | 12000 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802344 | ChrepMp08,801489,rtl | (1 of 352) PF00078 - Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_1); reverse transcriptase-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTGCAATCCTGTTGCGTTTCTTGGTCTAACCAGACTTTTGGCTTCCG |
| Internal bar code: | GCTATAACGAGCTCGGTAACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 712 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGACCGCGAATTGTGCA |
| Suggested primer 2: | CGCTTTTGTATGGACTCGCG |