| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.076635 |
| Chromosome: | chromosome 8 |
| Location: | 1124192 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g362700 | SMM30 | (1 of 8) 3.4.24.71 - Endothelin-converting enzyme 1 / ECE-1; S-adenosyl-L-methionine-dependent methyltransferase | 5'UTR |
| Cre08.g362750 | (1 of 1) K01173 - endonuclease G, mitochondrial (ENDOG) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAACTGTCAAATGCGTCAGCGCTTCCTTCACCACGTACTTCTATGATG |
| Internal bar code: | CCTCTGTATTAAGTGCCACAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 501 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTCCTCGATTCCTTGGCA |
| Suggested primer 2: | CATCAACACAGCCCCTGTCT |