Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.076751 |
Chromosome: | chromosome 2 |
Location: | 6249826 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g387150 | HSF1 | (1 of 1) PTHR10015:SF162 - HEAT STRESS TRANSCRIPTION FACTOR A-1A-RELATED; Heat shock transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACACACCCACACAGCCCAGCCCATCATGCTGTACTCACACTCTTACA |
Internal bar code: | TCGAGTGTTGCCAGATCACCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3635 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCATGTTGCCGTACAAGGA |
Suggested primer 2: | AAACTAGTGCAAGCGCCTCT |