| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.076753 |
| Chromosome: | chromosome 6 |
| Location: | 2107463 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g266100 | (1 of 15) PTHR12291:SF23 - PROTEIN MEC-15 | 5'UTR | |
| Cre06.g800628 | (1 of 15) PTHR12291//PTHR12291:SF23 - FAMILY NOT NAMED // PROTEIN MEC-15 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTATCTGAATGGCTGCATCGAGCTGCTGGCTACCACTGGAGCGACGTG |
| Internal bar code: | TAGCCTGTACAGAGTGCAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2093 |
| LEAP-Seq percent confirming: | 69.8113 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCGTTGAATGCTCAGAG |
| Suggested primer 2: | TGCTAGAACCGTTCAAGCGT |