| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.076790 |
| Chromosome: | chromosome 1 |
| Location: | 4986985 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g034550 | FAP109 | (1 of 2) IPR002048//IPR003117 - EF-hand domain // cAMP-dependent protein kinase regulatory subunit, dimerization-anchoring domain; EF-Hand Containing Flagellar Associated Protein 109 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCCCCGCAAGTGTCACCACATAACCTTTCATTGTAGTTCGGCGACG |
| Internal bar code: | ATTCTCTCGATATGAGAGTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2297 |
| LEAP-Seq percent confirming: | 58.4906 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACCAGATACGCCTCGTC |
| Suggested primer 2: | AGCCTGGATCTGACTGCAAC |