Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.076805 |
Chromosome: | chromosome 12 |
Location: | 2140085 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g509750 | QCR2,MPPA2 | (1 of 2) 1.10.2.2//3.4.24.64 - Quinol--cytochrome-c reductase / Ubiquinone--cytochrome-c oxidoreductase // Mitochondrial processing peptidase / Processing enhancing peptidase; Ubiquinol:cytochrome c oxidoreductase core II subunit of mitochondrial Complex III | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTCCAGAAATCGGGGCCATCGTGTCGCTTGGGTTTCGTCAAGCAGTCT |
Internal bar code: | TCTAGGTCGTCCGCGGTCACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3184 |
LEAP-Seq percent confirming: | 93.8775 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCGTCAAGGACACGAGTT |
Suggested primer 2: | ACTGATGTGAGGTGGCCATG |