| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076856 |
| Chromosome: | chromosome 6 |
| Location: | 7904208 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304000 | SRH14 | (1 of 1) PTHR10799:SF580 - INTEGRATOR COMPLEX SUBUNIT 10-LIKE PROTEIN; SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGATCCCGGTGGATTCGCGAAGCTGACTGGGATTCGGGCGGCCTGGGG |
| Internal bar code: | GAAACGTTGTTTGTCTGCGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 783 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGTGCTATGACATGC |
| Suggested primer 2: | GGCACAAGAACACCATCAGC |