Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.076885 |
Chromosome: | plastome |
Location: | 33796 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802283 | rps4,ChreCp020,2716955 | 30S ribosomal protein S4; (1 of 1) PTHR11831:SF4 - 37S RIBOSOMAL PROTEIN NAM9, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGACGTCCCCTTCGGGATTTTAATGCTCCGTTAGGAGGCAAATAAATTT |
Internal bar code: | CTTGGTATCCTCTCACAGTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 145 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTAGGACGTCCCCTTCCC |
Suggested primer 2: | CAGCAGCACGCCAACTTATT |