| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.076889 |
| Chromosome: | chromosome 2 |
| Location: | 2529610 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092284 | (1 of 1) 1.13.11.19 - Cysteamine dioxygenase / Persulfurase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTGCCCCCTCCCCCACTACAATGCAGTAGCAACCCACGATGCGTTCCA |
| Internal bar code: | GGCGCGTCTGATCTGGTGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 182 |
| LEAP-Seq percent confirming: | 13.6364 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGCAATTGCACCTACTAC |
| Suggested primer 2: | AGGCTCGCTATCAGCATGTC |