Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.076906 |
Chromosome: | chromosome 5 |
Location: | 2006144 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g236400 | NAT13 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1); N-acetyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCGGCTGCTGCTACTCCTATCTTGCATGGGCGTGTTTGCCACGTAGC |
Internal bar code: | CAAGGAGCTGTGGGGCGGTGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 90 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGGTCGTATTGGCCGTAG |
Suggested primer 2: | CTGCACTGCCACCCATTCTA |