Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.076922 |
Chromosome: | chromosome 7 |
Location: | 4932045 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g346750 | PUS14 | (1 of 2) 5.4.99.28//5.4.99.29 - tRNA pseudouridine(32) synthase / Pseudouridine synthase RluA // 23S rRNA pseudouridine(746) synthase / 23S RNA Psi(746) synthase; RNA pseudouridine synthase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAACACACAAGGAATGCGTGCGCAAGTTTACTGAGGGACGCAAGGACG |
Internal bar code: | TTTTCCGACCGCAATTGTCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1073 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGCCCGCATGTTCAAAAA |
Suggested primer 2: | TTCGCGTGGTGGAAATGGTA |