| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.076982 |
| Chromosome: | chromosome 15 |
| Location: | 338526 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g635350 | PRM4,PRMT4,CARM1 | (1 of 1) K05931 - histone-arginine methyltransferase CARM1 [EC:2.1.1.125] (CARM1, PRMT4); Protein-/Histone-arginine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTATGGCATTTGTACACACGGTATGTCGGGCACACGACTACAGCTG |
| Internal bar code: | GGTTAGAGTACTTGGGAATTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 12.9032 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGCAGGAACGTTGGGGTG |
| Suggested primer 2: | AGGACTCATGGCCCCATACT |