| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.076992 |
| Chromosome: | plastome |
| Location: | 34501 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802283 | rps4,ChreCp020,2716955 | 30S ribosomal protein S4; (1 of 1) PTHR11831:SF4 - 37S RIBOSOMAL PROTEIN NAM9, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGTACTTTATTTTACACTTTATTTTACACTTTATTTTACACTTTAT |
| Internal bar code: | GGCCGATTAGGTGAGCGAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 50 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTTCGGGCAACTAAAGT |
| Suggested primer 2: | GCAAAGCCGATTCCCAAAGG |