| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077000 |
| Chromosome: | chromosome 3 |
| Location: | 5739664 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187250 | (1 of 1) PF05514 - HR-like lesion-inducing (HR_lesion) | 3'UTR | |
| Cre03.g187300 | (1 of 52) 2.7.11.22 - Cyclin-dependent kinase / Cdk-activating protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCGGCATGCTGGAAGGCTGGCGCGACTGTTGGCATGGGCGCGTTGGC |
| Internal bar code: | GAAGAAGCCGGTTATAGTTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4981 |
| LEAP-Seq percent confirming: | 98.0198 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGCTGGTATGATCGGAGG |
| Suggested primer 2: | GGTTATCTCGAGCGACCCAG |