| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077001 |
| Chromosome: | chromosome 8 |
| Location: | 93374 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358526 | AAA1 | Plastidic ADP/ATP translocase; (1 of 4) K03301 - ATP:ADP antiporter, AAA family (TC.AAA) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGCTGCCAAACAGGGCTGGCCGCGACGAAGAGCTGGGCAAGCTAGACC |
| Internal bar code: | CCTATGGTAGCACTGTTCTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2526 |
| LEAP-Seq percent confirming: | 79.4118 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCACAACCACCCCAAAAA |
| Suggested primer 2: | CCCGCTGGCAGTCTATACAG |