Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.077012 |
Chromosome: | plastome |
Location: | 175326 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802329 | ChreCp064,psbD,2716961 | (1 of 1) K02706 - photosystem II P680 reaction center D2 protein (psbD); photosystem II protein D2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAAGTAACGAAAGTAGTACCAGTTAACCAACCACCTAATGCAAAGTA |
Internal bar code: | TGTTGCCGAGGGTGAGGGGAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 54 |
LEAP-Seq percent confirming: | 23.0769 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGGGATAGGCCAGGCAAT |
Suggested primer 2: | ACGGAATGTGTTAGCACCGT |