| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.077025 |
| Chromosome: | plastome |
| Location: | 61072 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802288 | rps7,2716973,ChreCp024 | 30S ribosomal protein S7; (1 of 2) K02992 - small subunit ribosomal protein S7 (RP-S7, MRPS7, rpsG) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTTATAAACTGGATCTGGTAATAAAGTACGTTTTTTATTAATGGGAC |
| Internal bar code: | CCTCATCGCGTGAAGGCGTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 45.4545 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAACATTCTCCTTCCGA |
| Suggested primer 2: | CCCCTTCGGGCAACTAAAGT |