| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077039 |
| Chromosome: | chromosome 15 |
| Location: | 2961021 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g643600 | SUF2,SUFB1,SUFB | Iron-sulfur cluster assembly protein; (1 of 1) PTHR30508//PTHR30508:SF1 - FES CLUSTER ASSEMBLY PROTEIN SUF // UPF0051 PROTEIN ABCI8, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATCCCCCAGCCCTCCGCCTGCTCCCCCCCTCCCTCCCCTCCTTGCCGC |
| Internal bar code: | TTTCGTAGGGCGTTTGGCTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 348 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGAAGGGGAAGTGGTTG |
| Suggested primer 2: | GTTGGGGTGGGGGATTGTAG |