| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077049 |
| Chromosome: | chromosome 16 |
| Location: | 5375095 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683250 | (1 of 1) PF05832 - Eukaryotic protein of unknown function (DUF846) (DUF846) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCCCACTGCTCTGTCACCCGCAGGACCCCTCCAACCCTCTTTAGTTG |
| Internal bar code: | TGAATGGGCATTAGTGACCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3038 |
| LEAP-Seq percent confirming: | 98.8372 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCTGCCCTTCCTCTTTTA |
| Suggested primer 2: | GGAAGACGCACTCACCTCAA |