Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.077124 |
Chromosome: | chromosome 1 |
Location: | 2759092 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g016700 | (1 of 781) IPR000104 - Antifreeze protein, type I | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGTGACGGTGATGGGTGATGTGACGGTGATGGGTGATGTGACGGTGA |
Internal bar code: | GTTTCTTATGAGCTATCGCCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2302 |
LEAP-Seq percent confirming: | 96.0784 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAACACACCTGCTGACACG |
Suggested primer 2: | TGAGACAAACCGCAGCAGAT |