| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077137 |
| Chromosome: | chromosome 16 |
| Location: | 2739946 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662000 | HEL62 | (1 of 1) K17679 - ATP-dependent RNA helicase MSS116, mitochondrial [EC:3.6.4.13] (MSS116); DEAD/DEAH box helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCAGGTGGGCCGGGGCTGGGAGGCTGGGGGCCCGGGCTGGGGGCAAGC |
| Internal bar code: | AATAACTCTTGAACGTGGAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 979 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGCAGTGTGAATTGCC |
| Suggested primer 2: | CTGTTTGTTGTCGCTCACCG |