| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077184 |
| Chromosome: | chromosome 3 |
| Location: | 5727715 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187050 | PHT4-3,PHT3,PHT4C | (1 of 1) K12303 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 9 (SLC17A9); Na+-dependent inorganic phosphate cotransporter | outside_mRNA |
| Cre03.g187100 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGTGCCTACCACTTTCACTGCCTAGACGACCTGGCATCCATTTGCCTC |
| Internal bar code: | TTTGTTTCGTTCGGCTTTTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 643 |
| LEAP-Seq percent confirming: | 22.0339 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACATCACCAACCAGGCC |
| Suggested primer 2: | GAAGTTCGGACACCCCAGAG |