Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.077223 |
Chromosome: | chromosome 9 |
Location: | 3240085 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394769 | (1 of 14) PF03133 - Tubulin-tyrosine ligase family (TTL) | 3'UTR | |
Cre09.g394806 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCCCGATAATCGCAACGTGCAGCGCCGGGGTCCTTCTAAACGTTGGG |
Internal bar code: | ATTATTCGAGCGGTCAAATATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 78 |
LEAP-Seq percent confirming: | 7.14286 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATCTCGAGGCAGCAGAGTC |
Suggested primer 2: | CCGGATAGTACACACGACGG |