| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077225 |
| Chromosome: | chromosome 1 |
| Location: | 2413195 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g013801 | SXD1,TCY1 | (1 of 1) 5.5.1.24 - Tocopherol cyclase; Tocopherol cyclase 1 | 3'UTR |
| Cre01.g013850 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTACGTCCGTCCATACTACGCGTACGTATTGGCGTGTGCGATGGGAC |
| Internal bar code: | CAACGGAGAGGGGTTTACCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1048 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTGGTTAGGCTTGGGAT |
| Suggested primer 2: | AGGATGAGGACGAGGACGAA |