Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.077232 |
Chromosome: | chromosome 3 |
Location: | 6890773 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g198000 | PPP15 | (1 of 2) PF00481//PF13672 - Protein phosphatase 2C (PP2C) // Protein phosphatase 2C (PP2C_2); Phosphoprotein phosphatase 2C-related | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAGTTGAACAGGGGGTGGGCTGGGTCGAGAGGATTTCCATAGATAGCC |
Internal bar code: | TTTTTGGTAGCCCGGCACATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 296 |
LEAP-Seq percent confirming: | 8.33333 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGAGGCTTCGGTCACAC |
Suggested primer 2: | CCAACACGGCAAAGATTGGG |