Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.077251 |
Chromosome: | chromosome 3 |
Location: | 1897303 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g154850 | COQ4 | Ubiquinone biosynthesis protein; (1 of 1) K18586 - ubiquinone biosynthesis protein COQ4 (COQ4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGCTCTTCGACATAAGTTTGTAACACACAACACACACGCACACACC |
Internal bar code: | GCCGTCCGAGTCCTTGCTCCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 462 |
LEAP-Seq percent confirming: | 38.2353 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTGTGTTGTTCTGTCACC |
Suggested primer 2: | GCCATCGCCCTGTCATGATA |