Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.077261 |
Chromosome: | chromosome 17 |
Location: | 3460769 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g723650 | KAT1,ATO1 | (1 of 1) 2.3.1.16 - Acetyl-CoA C-acyltransferase / Beta-ketothiolase; 3-oxoacyl CoA thiolase/acetyl-CoA acyltransferase 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCAAAAATGGAGAGCTCAGCGCAGGCGCGCCTGGCGGTCCTGTCTCG |
Internal bar code: | GACAAGCTTTAGACATGCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2172 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTCTCGGATCTCTGCTCC |
Suggested primer 2: | TTCTGGTCTTCGTCACTGCC |