| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077262 |
| Chromosome: | chromosome 2 |
| Location: | 4940292 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110150 | (1 of 1) PF00651//PF03110//PF07707 - BTB/POZ domain (BTB) // SBP domain (SBP) // BTB And C-terminal Kelch (BACK) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTAGATTGCTCCACGGCGCCATGCTGGCATGGTCGCTGTGGCAACGC |
| Internal bar code: | CAAGAATAGGTTTCGGCGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4407 |
| LEAP-Seq percent confirming: | 60.5505 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCGTTTTGCGCTTATGAT |
| Suggested primer 2: | CCAAACTTGTTCAGGCCGTG |