| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.077274 |
| Chromosome: | chromosome 5 |
| Location: | 2423263 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238650 | PHC5 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCTTACCGCTGACACTCTCCTTCCCTGCCCCGCCCCTTCCCCGCTTGC |
| Internal bar code: | ACGTTTTTTGATCAAGCAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 342 |
| LEAP-Seq percent confirming: | 54.1667 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTTTGCCATCTTAGCGC |
| Suggested primer 2: | GTTCGTGGAGTGCAGAGTGA |