| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077322 |
| Chromosome: | chromosome 6 |
| Location: | 8492516 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309050 | NOT2 | (1 of 1) K12605 - CCR4-NOT transcription complex subunit 2 (CNOT2, NOT2); Negative regulator of transcription | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGCGCGTGCTCTCGCCTAGCCTGTGTGCAGGCTGGCGAACTCTGCCG |
| Internal bar code: | TTTAGACAAAGGGACTAAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4041 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTCGCCACTAACAAGAGT |
| Suggested primer 2: | GTCTCCTGGCTTTCCACGAA |