| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.077332 |
| Chromosome: | plastome |
| Location: | 100270 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802306 | 2716993,ChreCp042,rpoB1 | (1 of 2) K03043 - DNA-directed RNA polymerase subunit beta (rpoB); RNA polymerase beta subunit I | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGGTTAGACAAAGAAACATGACTCACTGTCTATATGTTAAATATTT |
| Internal bar code: | GAGCATCTTGCCCTCATAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 116 |
| LEAP-Seq percent confirming: | 36.3636 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCCACACTGGCCGGTAAG |
| Suggested primer 2: | GGTTTGAGCTAATAGGGCCGT |