| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077373 |
| Chromosome: | chromosome 9 |
| Location: | 5246562 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407100 | MRPS5,uS5m | Mitochondrial ribosomal protein S5; (1 of 1) PTHR13718:SF61 - 28S RIBOSOMAL PROTEIN S5, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACACATGCACGCACGCGCCGCTGCAGACGCCTGTTCGTGGCCGCGGCA |
| Internal bar code: | TATGAATCAAATACGTACTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 90 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACTCTTACGCTGAGGC |
| Suggested primer 2: | GGGAGCTGTTTACACGGTGA |