| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077394 |
| Chromosome: | chromosome 12 |
| Location: | 8858711 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546350 | GEX157 | (1 of 4) PF05653 - Magnesium transporter NIPA (Mg_trans_NIPA) | 3'UTR |
| Cre12.g546400 | DLR2,DLC7b,DCL7B,LC7B | (1 of 2) K10419 - dynein light chain roadblock-type (DYNLRB, DNCL2); Roadblock/LC7 Family Light Chain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGGCCCGGGTCACTACAAGAGAATCTACACGGCCCAGCTCTAAAC |
| Internal bar code: | GTATAGCCAGATTCCAATATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1381 |
| LEAP-Seq percent confirming: | 2.5641 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACTGAACGTGACGTGACC |
| Suggested primer 2: | TATGGATGCAGGGCGTCATC |