| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077401 |
| Chromosome: | chromosome 12 |
| Location: | 1122647 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g491050 | RIR2A,DIV17,NSG2,RIR2 | (1 of 2) K10808 - ribonucleoside-diphosphate reductase subunit M2 (RRM2); Ribonucleoside-diphosphate reductase R2 subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGCCCGCGGCCGCTGCAACATTGTATCACACGCACACTATATCCGCG |
| Internal bar code: | TCGCGTGATCATGTTGCCCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2295 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCGCAGTACATCCAGTTT |
| Suggested primer 2: | GAATACGAAGCTGCGCACTG |