| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.077436 |
| Chromosome: | chromosome 2 |
| Location: | 1194235 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081450 | CGL123,MRPL25,bL25m | (1 of 1) PTHR33284//PTHR33284:SF1 - FAMILY NOT NAMED // RIBOSOMAL L25/TL5/CTC N-TERMINAL 5S RRNA BINDING DOMAIN-CONTAINING PROTEIN; Mitochondrial ribosomal protein L25 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTTAAGGGCTTCAAAACGCGCGATGGCGCATCGTTAACATATCATACA |
| Internal bar code: | CCAATATGGCAATCAGGTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4043 |
| LEAP-Seq percent confirming: | 86.3636 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGGGTGATGGTAGCTGC |
| Suggested primer 2: | CATATGCATGCCCAGGTTGC |