| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.077478 |
| Chromosome: | chromosome 17 |
| Location: | 2024738 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710850 | TPT4,TPT29 | UDP-xylose transporter; (1 of 4) K15285 - solute carrier family 35, member E3 (SLC35E3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCATGCACACCACCATCACGCTGGCCACGATGCGCGCGGGCGGCACG |
| Internal bar code: | TTGTAAAGTTAATTATCGCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCAAGTCCATTCCCCAGG |
| Suggested primer 2: | TCCTTCTGTTTGGATCCGGC |