| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077483 |
| Chromosome: | chromosome 9 |
| Location: | 3406565 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395732 | (1 of 5) IPR000104//IPR001623 - Antifreeze protein, type I // DnaJ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTTCGGCCTGTCACCACGTCCTACGCCACGAATCCGACCTGCCCCTGA |
| Internal bar code: | CGTTATGCTTAGTGAGATCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2254 |
| LEAP-Seq percent confirming: | 93.2432 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTATTCGACTCGCTCGGAA |
| Suggested primer 2: | AGAATGCCTGTAGCCACACC |