| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077500 |
| Chromosome: | chromosome 6 |
| Location: | 4749162 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279474 | MUT68 | (1 of 12) 2.7.7.19 - Polynucleotide adenylyltransferase / RNA adenylating enzyme; Terminal uridyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACAGCACTCAAGCGTTCAATTATGACCCTTACGTCATCTTAAGGACT |
| Internal bar code: | TGTCTGTCTGTACTTTGTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5601 |
| LEAP-Seq percent confirming: | 99.4792 |
| LEAP-Seq n confirming: | 191 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 192 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTAGCTTCCTTCTCGAGCG |
| Suggested primer 2: | CTCCCTCCAACACACACTCC |