| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.077517 |
| Chromosome: | chromosome 3 |
| Location: | 6792596 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g197000 | POB8 | (1 of 1) K14847 - ribosome production factor 2 (RPF2); Proteome of basal body 8 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCCATCTACCCCTCGGCGCAAGCTCACGTCAACTTAGTGCACTCCAG |
| Internal bar code: | TGTTAAGCGAAAATATCGTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4737 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGCAAAAGAACGTGTCA |
| Suggested primer 2: | ACTGTTGCTGAGAGAGGTGC |