| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077520 |
| Chromosome: | chromosome 1 |
| Location: | 1855250 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800034 | (1 of 1) K14000 - ribosome-binding protein 1 (RRBP1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCGGCCGCCTGCTCCGCCTTCGCCTGCGCCGCCGTCGCCTGCGCCTC |
| Internal bar code: | GAAGTGGTTACGAAGCTCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 256 |
| LEAP-Seq percent confirming: | 4.65116 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | |
| Suggested primer 2: | CGTCCCCTAAGCCGCCTG |