| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077521 |
| Chromosome: | chromosome 11 |
| Location: | 126906 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467536 | (1 of 38) IPR000719//IPR002290//IPR011009 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCATCAGGGTTTGGTTCCGCGTATTCGCTAGCCCAAATACACCGTTTC |
| Internal bar code: | ATGGGCGCTAATGTGTAGTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 502 |
| LEAP-Seq percent confirming: | 26.1905 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACATGTCAGCACCACGC |
| Suggested primer 2: | CGCCAATACTAGAGCGCTGA |