| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.077525 |
| Chromosome: | chromosome 17 |
| Location: | 1747008 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g708650 | HFO27,HFO20 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCCAAACAAACTCGGTGTTTCTCAACACCACCCTCAAACCTCGGGCT |
| Internal bar code: | TTTTCTTAGTAGATGTGAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2387 |
| LEAP-Seq percent confirming: | 43.9024 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCCAGCAAAGACCCTAA |
| Suggested primer 2: | TCGTTGACTTGGATCCTGCC |