Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.077556 |
Chromosome: | chromosome 9 |
Location: | 4310511 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g801053 | (1 of 30) PF00078//PF03372 - Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_1) // Endonuclease/Exonuclease/phosphatase family (Exo_endo_phos) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCCCGGCTG |
Internal bar code: | TACTGTACTCGTTAGATGCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 41 |
LEAP-Seq percent confirming: | 4.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGCCCTGCAAGCTAAGAC |
Suggested primer 2: | CACTCCAGGAAGATGTGCGT |