| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.077603 |
| Chromosome: | chromosome 1 |
| Location: | 7419942 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g052350 | MRPL20,bL20m | (1 of 1) K02887 - large subunit ribosomal protein L20 (RP-L20, MRPL20, rplT); Mitochondrial ribosomal protein L20 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTATATCATTTTTATAGTCAAGTATACACTAATTGCGACAGCGCGCC |
| Internal bar code: | TGTGCTGTAATAGTCCGTTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1316 |
| LEAP-Seq percent confirming: | 27.2727 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCTAATGAATCCTCGGCC |
| Suggested primer 2: | CTTAAAGCTGAACGGCTCGC |