Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.077639 |
Chromosome: | plastome |
Location: | 196680 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802335 | rpoC1,ChreCp069,2717049 | (1 of 2) K03046 - DNA-directed RNA polymerase subunit beta' (rpoC); RNA polymerase beta' chain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCCTGTTTTAAAAATGTCAGGCCAATTTACTATTTCAGATTTAAATC |
Internal bar code: | TTTAAGTTTGTTGTGGGGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 181 |
LEAP-Seq percent confirming: | 26.3158 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGGCCATTTGGTCACCAT |
Suggested primer 2: | CTCCAAAATCGGGCGTCAAC |